MARVEL 2000 PRESENTS...

Now.

“Holy shit!” Deadpool, otherwise known as the Merc-With-A-Mouth, eloquently exclaimed in response to the re-emergence of the immortal Apocalypse. The restructured Weapon X Program had commissioned Deadpool’s services to apprehend the zombified assassin known as T-Ray. After T-Ray was hooked up to a mysterious machine, everyone in the lab (including T-Ray himself) was vaporized and the gray-skinned Apocalypse appeared as an end result—apparently to everyone’s surprise. Even Weapon X.

“DIE!” was Deadpool’s next verbal barrage as dozens of bullets escaped the barrels of his twin Uzis like a firework display. Of course, the bullets were either absorbed into or ricocheted off of the skin of the ageless mutant. He opened his eyes and smiled.

“Not exactly the welcome I was expecting,” Apocalypse mused. He flexed his bicep and marveled at its solidity. “Hmm…that machine made me younger. I feel as spry and as powerful when I was a mere one-hundred-year-old…perhaps even younger.”

“Y-you’re En Sabah Nur…,” Deadpool muttered, trying to slow his racing heartbeat. “The First One! You’re like worse than crabs! Fuckin’ never die! The X-Men are gonna be pissed, nigga!”

Apocalypse suddenly became annoyed, “Actually, the correct Arabic translation is Sabah an-Nur.”

Deadpool ejected the empty clips from his guns and paused. He raised an eyebrow, “And you say something now? Aren’t you older than Jesus?”

Apocalypse shrugged, “Similar to Jehovah being a misinterpretation of Yahweh…I just got tired of trying to explain after about 500 years. Eventually, I just accepted it. But now…” He shook his finger assuredly, “Now, it will be different.”

“Different, eh?” Deadpool asked as he panted, unhooking a grenade from his belt. After making sure Apocalypse wasn’t looking, Wade lifted up his mask and pulled the pick out with his teeth. He grunted as he hurled it through the air towards his target, “Why’s that?!”

The small sphere hurtled towards Apocalypse as hundreds of bits of shrapnel and heat exploded in front of his body. Without flinching, the mutant simply laughed. He looked down at his hands, which were charred with soot. He arched an eyebrow and seemed to frown, “My techno-organic infection is gone…how?”

Deadpool unsheathed his katana and charged at Apocalypse, “I don’t know, but something tells me you shoulda stayed where your smelly Mummy reject ass—urk!”

Apocalypse carelessly held Deadpool around the neck with his thumb and index finger, “I feel truly reborn for the first time in five millennia. Do not ruin this moment for me.”

“Guh…okay!” Deadpool wheezed. He struggled for a brief moment as he tried to loosen Apocalypse’s grip by flailing his legs like a small child playing on monkey bars. “Let me go! Come on! Uncle!”

Apocalypse grinned as he simply tightened his grip, “And by the way…Jesus of Nazereth? I watched him die—which proved that I was truly meant to survive above ALL ELSE!” Sabah an-Nur pressed on until a deafening and sickening pop rung in his ears. Wade’s eyes rolled back into his skull as his lifeless body collapsed on the floor.

“Now,” Apocalypse sighed, “to finish where I left off. WHERE is he?”

Olympus.

A bright blue sky copulated with soft misty clouds in what seemed to be an endless realm of what one would perceive to be heaven. The dominion of the deities that was worshiped by Romans and Greeks alike was a virtual ideal paradise—despite its inhabitants’ own infighting, cattiness, deceit, and jealousy.

“I brought you your hellhound, Hades,” a man with a gruff voice uttered amongst the entire Pantheon. The white-haired being had a certain yellow spectral glow around him as he looked down at the three-headed beast, which was now missing an appendage…giving it three legs. This particular person stood in the epicenter of white columns, nude statues, and friezes. Twelve different deities were seated around him, all with their distinct looks, hairstyles, and clothing. He remembered the ancient myths. Most of them were true.

“You’re lucky it wasn’t on the mortal plane,” the white-haired man growled.

“You have no right to pass that kind of judgement in MY kingdom, Traveler,” the mighty infamous Zeus demanded as he sat on his white marble throne. “My brother has little time to tend to every accident that occurs.”

“This is the sixth time Cerberus has escaped,” the man known as the Traveler reminded.

“I can vouch for myself, Zeus, thank you,” the black-robbed god of the dead hissed as he sat at his seat.

“My jurisdiction has no bounds,” Traveler said simply, without a hint of emotion.

“Olympians do not need to be bullied about,” Hera, the Queen of the Gods, retorted arrogantly. “We govern ourselves. You are not the Living Tribunal!”

“But you do know who granted me godhood,” Traveler stated through clenched teeth. “I’ve been one with Eternity, with Chaos…with the cosmic energies that created all of you. Believe me when I say I don’t let bad people off the hook.”

Traveler suddenly felt a firm, but friendly grip on his shoulder, “Come now.” He turned around to be rewarded with the presence of the boastful hero known the world over as Hercules, “This is nothing that a few drinks will not handle. Dionysus! Get us some alcohol!”

The red-bearded god frowned, “I’m not just the god of wine, you know. I…ugh. You’re not even supposed to be here!”

“Just let the boy have his fun,” Zeus muttered as he lazily rested his cheek on his fist.

“Not now, Herc,” Traveler said as he held up a hand. “This has to be done. I’m tired of repeating myself.”

“Cerberus is but a puppy!” Hercules bellowed as he began to playfully wrestle with the disoriented (not to mention dismembered) guard dog, who simply whined. “Who cares if he escapes? He’s like all canines. You remember those, do you not? I know you haven’t forgotten your mortal life prior to becoming a full-fledged god—I haven’t.”

“What I think my brother is trying to say,” Ares said with a grim smirk, “is quit being such a fucking busy body!”

Traveler’s eyes glowed, “If someone did my job thousands of years ago, maybe you wouldn’t have taught humanity warfare.”

Ares grabbed his Spartan-like helmet and marched up to Traveler’s face, “Ah. That’s it, is it? The soldier trying to preach out against war because of all the regret—all the lives lost? Blaming ME for humanity’s problems is just as pointless as blaming the Olympians or ANY god! I really used to admire you when you were mortal.”

“Sit down,” Traveler warned.

“Okay, kids,” Hermes sighed as he flew in between the two machismo gods.

Ares turned back to his seat, but not before shouting, “If there’s a cosmic war between gods, so what? You have no pantheon to belong to. We are not your business! If you’re allegedly more powerful than any of us, why can’t you manipulate the mortal plane…or even visit it?”

Traveler’s eyes returned to their natural blue state. His piercing gaze suddenly felt sadness, a particular human emotion.

“That’s right!” Ares smiled boastfully, “You’re not special. You’re a prisoner. Trying to place false blame on other gods because he’s mad that he can’t ever go home again.”

“Ares!” Hercules shouted belligerently. “I swear I will break you for those comments.”

Traveler huffed and promptly began to float out of the temple. Hercules grabbed Traveler by his blue cloak, “Traveler! Listen to me! Ignore these idiots. Their immortality has rotted their minds. I understand you. We are friends, you and I. Cut from the same cloth.”

“Except for the part where my dad is a promiscuous fathead, thunderbolt-throwing god and my godhood being a curse, and yours an option other than dying on a funeral pyre,” Traveler said. His surroundings suddenly turned to blackness, yet Hercules followed him. He signed, “Sorry, Herc. I trust you. And you’ve been a loyal friend, but…”

“But what?” Hercules asked. He laughed, “Why would anyone view godhood as a curse? You can’t visit your loved ones, but you can see them, can’t you? You have the omnipresence most of us dream of. I thought you were content that your mission on Earth was over?”

“I was,” Traveler said. “But then I realized I still had more to do. Fix something.”

Hercules smiled heartily, “Save more lives? Join the Avengers? Fight alongside the greatest heroes of all time—like I did?”

“Myself,” Traveler iterated. “I meant fix myself. I guess you wouldn’t understand, Herc. You can come and go as you please on Earth. I’m restricted to the NC-17 godly visions of past, present, and future of every possible timeline. Watching my family and friends, their ancestors and descendants, being born, making love, and dying. On a perpetual loop.” Traveler pulled away his blue cloak, “And do you know what I can’t see?”

Hercules shook his head, somewhat unnerved by his friend’s heartache.

Traveler grit his teeth, “The timeline I grew up in. I remember it…but it’s not part of the cosmic thread of infinity.”

“You prevented your future from occurring,” Hercules reminded with a smile.

“But that’s not possible!” Traveler growled. “Every action creates a new reality somewhere. Reed Richards had this theory…wish I would have listened to him. Killing Apocalypse wouldn’t have mattered.”

“I’m sure it mattered to someone,” Hercules said. “You have to realize sometimes you make your own destiny, regardless of what you think has been done to you.” Hercules waved as he started to fade away, out of the endless void the mysterious Traveler called home, “At the end of the day, you have to make yourself happy somehow…”

With that, Nathan Summers bowed his head as Hercules returned home, and muttered, albeit somewhat sarcastically, “Thanks.”

Now.

There was a knock at the door, something Diana wasn’t used to at this late hour. She quickly threw on a silk robe over her nude form and auspiciously approached the front door to her Bangor, Maine home. Before she turned the knob, however, there was a strange thump that she felt inside of her skull. An awareness that something was about to go awry.

She couldn’t sense the mind of the person standing on the porch.

*SKUK*

A blade pierced its way through the oak door as if it were cardboard, just inches from Diana’s face.

“AHH!” she yelped as an invisible ripple unconsciously blanketed her in a telekinetic bubble. Diana tumbled backwards as the door was kicked off of its hinges by a vengeful man. He wrenched his katana out of the discarded door and held the blade to Diana’s throat.

“What did you do?!” he screamed.

“W-Wade?” Diana said shakily. She looked over at her lobby desk and felt around with her telekinesis to make sure her 9MM was still in the top drawer, loaded. Dr. Russell was an incredibly successful psychologist and parapsychologist to be sure, but one with secrets…and an enemies list.

“You used me to bring him back?! Apocalypse?! The same asshole who warped the world into some kind of new Dark Age and let a bunch of people die in the process?!” Deadpool growled.

“What?!” Diana shouted. She shook her head, “Dr. Colcord wanted to bring Cable back…not…oh God…” She gripped her temples, “Psionic wave. He’s more powerful than ever! Astral plane is expanding…just to compensate for his presence…”

“I want answers!” Deadpool demanded as he inched his katana’s edge closer and closer to Diana’s throat. “I swore I wasn’t going to be anyone’s puppet! And helping to bring back a maniacal Darwinist isn’t going to look good on a resume!”

“ARRRRG!” Diana shouted as blood poured out of her nose. She closed her eyes, “Get me my aspirin…please! I’ll tell you everything, but I need aspirin before I have a stroke! I’m not young anymore…my mind can’t handle this…”

Deadpool ripped off his mask and threw it onto Diana’s lap, “You had better, lady!” When he sheathed his katana on his back, he pointed to his face, “Or I’ll look prettier when I’m through with you!”

“Jean?” Scott Summers asked as he flicked the light switch on in the Xavier Institute’s sick bay, located several hundred feet underground. Jean Grey-Summers, wearing only a form-fitting black nightgown, had her back to her husband. She held a bloody tissue to her nose as she idly stood in front of her comatose daughter, Rachel. Cyclops adjusted his ruby-quartz sunglasses and cleared his throat, “Are you sleepwalking?”

Jean turned back and glanced at the X-Men’s field leader and back at her daughter. It was strange that she rushed to check on her. She never really considered Rachel to be “hers” at first—considering she was from an alternate future reality. But Rachel had been an X-Man, as well as a host to the Phoenix, in Jean’s stead. Part of Jean knew it was horrible to think, but Rachel always seemed like her replacement. Maybe that’s why she always pushed her away.

“I felt a disturbance…and I just wanted to make sure she was okay,” Jean said.

Scott noticed the bloody wad of Kleenex which Jean tried to hide, “Must have been some disturbance.” He glanced out into the hall, gesturing towards the Cerebro Chamber, “Where did it come from?”

“I don’t know. Cerebro picked up a spike, that’s for sure. A big one,” Phoenix said. “I was thinking of contacting some of the other telepaths. Just to be sure.”

Cyclops smirked, “You know I’m all for efficiency…but this early in the morning?”

Phoenix half-smiled, “Trust me, Slim. Even just the low-level fortune tellers are up.”

Scott suddenly felt himself paralyzed with anxiety and fear—something rare for him. Jean sensed this immediately and asked, “Okay, sorry…that was a little condescending of me, I’m sorry.”

“No,” Scott said as he tried to ignore the dryness in his throat. He pointed behind Jean. The redheaded beauty turned around and failed to notice that their daughter had been sitting up throughout their entire conversation.

Rachel’s eyes were vacant and hallow. She didn’t move. She was in a coma for nearly a year. After using her tempo-astral abilities to try and discover the secrets of the Phoenix Force to prevent Madame Sanctity from accessing its power, she returned to her body in a vegetative state.

“Rachel…?” Jean asked. She held out her fingertips, barely touching her face, “It’s Jean. It’s okay. You’re at the mansion. Can you hear me?”

“Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah…” Rachel whispered over and over again.

Phoenix looked back at her husband with a look he never saw in her—despondency. Jean was always confident in her powers, but now, she had no hope of figuring out what happened to Rachel—and if the mysterious astral disturbance had anything to do with it.

Cyclops’s ruby-tinted shades flashed, “I’ll get Hank. Stay with her.”

“…the machine was supposed to bring back Cable,” Diana said as she gulped down a glass of water as she and Deadpool sat in her home office. She ran her hand through her graying blonde hair. “I had nothing to do with the manufacturing of it. I resigned from Weapon X years ago. I only agreed to screen you as a personal favor to Dr. Colcord.”

“You could have stopped it,” Wade muttered. “You could have—I dunno, made them. With your brain.”

“Despite my knowledge, my abilities are not as strong as they once were. I’m barely an alpha-class mutant,” Diana explained. “My specialties lie more in…subtlety. Mind control requires a lot of power I don’t have.”

“You can still read minds!” Deadpool yelled as he kicked over a stool. “You could have told someone!”

“And have them send someone over to kill me for leaking information?” Diana inquired. “What was I supposed to do? I thought Cable would be brought back, anyway. Not Apocalypse. I know Cable would figure something out and dish out justice to those responsible…”

Deadpool’s brow crinkled up in anger, “Yeah, and I’d be at the top of his goddamn list!” He flailed his arms in the air, “Do you even know Cable, lady?!! Do you know what he’s capable of? If I couldn’t heal fast, I’d be dead at least fifty times!”

Diana sat back in her chair and leaned her temple against her index finger, “I’ve treated him before, actually. So yes, I’d say I know him.”

“How well do you know him?” Deadpool demanded. “There’s something you’re not telling me! Why would Weapon X want Cable? I don’t understand! He’s from the future—he plans things out ten steps ahead. He’d only join Weapon X to infiltrate it and blow everyone involved away.”

“Weapon X is a small piece of something larger…,” Diana said cryptically. “That’s all I can tell you. If you want me to help piece together your mind so you can figure out the life purpose you’ve been looking for, you have to trust me.”

“Trust you?” Deadpool screamed. “Every word out of your mouth is a holier-than-thou psychology text book reading!” He unholstered an Uzi and pointed it at Diana’s temple shakily, “I can’t afford to trust you—or ANYBODY—anymore!”

“Jack…,” Diana pleaded calmly.

“What…?” Deadpool wondered as he withdrew his gun. He breathed heavily, “Was…is that my name? Was T-Ray right? WAS HE?!” He shoved the barrel into her face again.

A tear fell from Diana’s cheek, “That was your nickname in the Canadian army. You always carried the Jack of Spades in your ammo pouch…do you trust me now?”

“Then…I am Wade Wilson…?” Deadpool asked as he picked up his mask and stared into it. “He killed my wife…”

Diana’s chin quivered up as she shook her head, “It wasn’t T-Ray. He was insane. His grasp on reality was worse than yours. He had obtained your confidential information somehow, but twisted the facts around…Mercedes killed herself, Wade.”

Deadpool fell to his knees in utter despair, “…why? Was it something I did?”

Diana shook her head, “No, Wade. She was just…sick. There was a chemical imbalance. The desolation of the Canadian wilderness just made it worse for her. T-Ray tried to use the guilt of that against you. But it was never your fault, Wade…do you understand?”

Deadpool pulled his mask back on to hide his tears and sniffled, “How do I know you’re telling the truth?”

“You could have killed me anytime you wanted,” Dr. Russell said.

Deadpool clicked the safety on his Uzi and holstered it. He then walked out of the room into the darkness, “Sorry about the door.”

Diana yelled out, “What are you going to do, Wade?”

Deadpool turned his head as he approached his stolen military jeep from the Weapon X complex, “I’m gonna save the world, lady.”

Hank McCoy seemed to roar under his breath as his tired blue eyes fought to stay alert as he held a miniature medical flashlight in front of Rachel Summers’s eyes, checking her pupils’ reflexes. His blue fur was sticking up on one side of his face as he had been asleep in his laboratory for hours before. Luckily Scott was able to find him there and not somewhere off the mansion grounds.

“Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah… Phin-eh-as-ohk-par-ah…”

“Do you understand any of that, Hank?” Scott asked of Rachel’s indecipherable speech patterns. Jean stood somewhat anxiously behind him. Part of her felt embarrassed her immense powers couldn’t help her own daughter—alternate reality or not.

Hank grumbled, his voice slightly deeper and more gravelly from his fatigue, “I understand Phinehas. Nubian…or Hebrew possibly. And then…okpara? Whatever she’s saying, it’s phonetic.” He glanced to his right, “Jean, be a dear and activate the language cipher. About time we use some of our Shi’ar stuff.”

Nebraska.

Nathanial Essex rubbed his fatigued face as he sat in his secret labyrinth. In dealing with the Byron Agency and the X-Men, it seemed that Mister Sinister had bit off more than he could chew. His experiments have been far and few between ever since the death of Apocalypse. Ironic that he spent years pulling the strings to finally kill the ageless being to be distracted by other projects.

Now the shifting of the astral plane seemed to trouble Sinister. It seemed nothing was going his way.

“ESSEX!”

“You?!” Sinister bolted up in his chair as energy cackled around his clenched fists, but the behemoth who screamed his name had already wrapped his hands around his throat. He came out of nowhere.

“…you’re…supposed to be…dead!” Sinister gasped as he struggled to be free of the massive vice grip around his throat.

“I gave you life!” Apocalypse roared as his eyes glowed the same shade of red as Sinister’s. His fists doubled in size as he tightened his thrall around Sinister’s throat, eventually ending with the dismemberment of the geneticist’s head. Apocalypse stared into the vacant eyes of the torn-off skull, “I’m here to collect the debt you owe, you TREACHEROUS slave!”

*THUK THUK THUK*

Apocalypse winced as multiple dark blue blades of an organic origin pierced through his midsection. Blood curdled out of his mouth as he arched an inquisitive eyebrow. He smiled with a certain pride, “Oh, how resourceful you are…I taught you well, it seems.”

The head in Apocalypse’s hands melted into a white, soupy substance as dozens of Sinister’s duplicates—most likely his own clones—descended upon their template’s progenitor, yanking their shape-shifted limbs from his ribs.

“Well,” one of the Sinisters said as he crossed his arms with a smug grin, “how stupid did you think I was? Just sitting there for you to do what…kill me? I knew the risks of trying to kill you.”

Apocalypse smiled a toothy grin, “Trying?” His eyes briefly flashed as Sinister’s clones suddenly vanished. Apocalypse then tore off a section of his own flesh, which seemed to form itself into a bladed weapon—ancient Egyptian in style. Mr. Sinister, unnerved by his clones’ vaporization found himself to step back in shock.

“You should have tried harder,” Apocalypse roared as he leapt up and drove his sword directly into Sinister’s heart.

Sinister grimaced as he actually felt his nerves send a shock to his system. Blood seeped from the wound, much to his surprise as well. Apocalypse had granted Essex the peak of human potential—including an advanced regeneration ability. The same ability which seemed to have been negated by Apocalypse’s sword forged from his own flesh.

“I am Phinehasokpara, Nathanial Essex,” Apocalypse greeted. “I only tell you my true name because you will take it to your grave.” The Egyptian mutant extended his arms and looked upward as an invisible force propelled him upwards, through the ceiling of the laboratory.

Sinister fell to his knees and stared blankly at the sword. He grabbed hold of the hilt, but found it to be welded stuck to his own chest cavity. He wheezed as he crawled over to the seemingly organic computer console, “Computer…analyze the DNA of this…foreign object…cross-reference with recorded data tables…”

[[GACTTGCGATGAGGGGTTACA GACTTGCGATGAGGGGTTACA GACTTGCGATGAGGGGTTACA GACTTGCGATGAGGGGTTACA,]] the computer hummed. After a brief moment of idling, the computer brought up a screen with Apocalypse’s statistics and information. [[Identity confirmed. Mutant #0000001: APOCALYPSE.]]

Sinister peered more closely at the DNA coding, his eyes widened with shock and horror, “…that pattern…a pure DNA sample. No techno-organic irregularities…never saw it before…had no way of knowing…Computer, can you confirm this?”

[[Processing…Results confirmed. The Summers line descended from the progeny of Apocalypse over hundreds of generations.]]

“I want to relinquish my power and return to the mortal plane,” the Traveler said as he hovered upside down in the Lotus position. He had traversed himself long and far to get to his destination—instead of an endless black void, he was in an endless white void.

DOING SO WOULD CREATE A COSMIC IMBALANCE//LAWS OF THE UNIVERSE STATE THAT FOR EVERY ACTION, THERE IS AN EQUAL OR OPPOSITE REACTION//FOR YOU TO BECOME MORTAL, SOMEONE MUST TAKE YOUR PLACE//

Nathan sighed, “Can’t you bend the rules a little bit?”

YOUR ENERGIES MUST BE OCCUPIED FOR THE UNIVERSE TO HOLD ITSELF TOGETHER//YOU WERE CHOSEN BY THE CELESTIALS SO THAT YOUR RACE WOULD PREVAIL

“I didn’t make a DEAL with the Celestials!” Traveler growled. “That deal was made for me by someone else! A monster named Apocalypse!”

He felt a gentle grasp on his shoulder, which caused Nathan to fall on a solid stone floor. He immediately stood up and came face to face with the man who touched his shoulder. He had a warmth to him as he smiled at the man in the blue cloak. He had a work apron on over his white robes as he dragged a wood chisel against the back leg of a chair that he was constructing.

“Sorry,” the man said as he stood up, “my father can be a bit stubborn sometimes. Perhaps I can help you?”

“Will you set things right...?” Nathan Summers asked as he held out his arms.

“There are three essential forces in the universe,” Jesus Christ began as a light wind blew through his mane and beard, “One being equity, the others…necessity and vengeance.”

Nathan felt he already knew what the answer would be, “I don’t have time for this…a simple ‘no’ would have been fine by me. I’ll find another way.”

“Let me finish,” Jesus said. There was a commanding, yet fair tone to his voice that Nathan couldn’t help but obey—or at least listen to. “There is a balance to everything. You know as much as I that this is true. It is akin to karma…eye for an eye. The universe will usually find a way to balance itself out.”

Nathan shrugged, “For all my power, all I can do is watch. I can’t interfere without destroying entire dimensions…”

“But you tried once, didn’t you?” Jesus asked.

“Yeah…,” Nathan said as he lowered his eyes, “after the X-Men defeated Apollyon. I appeared and talked to those closest to me…but what I didn’t realize was that I destroyed a couple timelines in the process. I vowed never to do that again…but I need to get home. If you refuse, I understand…”

Jesus smiled assuredly, “While I never condoned violence, it is in human nature. Sometimes vengeance is a necessity in order to reestablish equity. Those three essential universal forces are related.”

Nathan remained steadfast as he asked, “Will you free me…? If you could go back and stop the Romans from even entering Judea—”

“Do NOT ask me that,” Jesus demanded. “Perhaps if I were born in your times and put on a costume, people would be more accepting of me. I am only doing this as a favor because you were pulled here against your will. It might have been your destiny to ascend, but clearly it was not.”

“If I do go back, people are going to die,” Nathan warned. “I’m not making any promises.”

Jesus knelt down and put the final touches on his chair, “Alright. Sit down.”

Nathan walked over and sat in the wooden chair. He looked up, “One more thing. I don’t want to remember those other timelines. Just my own.”

“Do you still want to know the future?” Christ asked.

Nathan found a smirk crawl onto his face, “No. Let’s make it more interesting…”

With that, the illusion was lifted. Jesus’ white robes were replaced with a deep violet as his arms became wilted and withered and his face too horrid to describe. The mistress known as Death kissed Nathan Summers on the cheek. He hadn’t traveled to Heaven—but into the Realm of Death itself…to seek out the Infinity Well and gain the knowledge he needed.

“Are you ready to be reborn, my love?” Death asked.

Unable to comprehend what exactly was happening, or what he was going to get himself into, Nathan nodded, “Yes.”

Death covered her face with her hooded robe, “Then bring them OBLIVION!”

Epilogue.
Then.

“You’re not using the Trask girl!” Diana shouted as she stood up and shoved Dr. Windsor in the chest. “Or any child for that matter!”

Dr. Windsor’s eyes appeared to turn glowing red for a moment, but quickly returned to normal, “I wasn’t talking about the Trask girl! I have discovered the mutant son of the X-Men’s Cyclops and his wife has a high probability of being what I have classified as an omega-level status.”

“Yeah, I read the file,” Diana said as she ran her hand through her hair, frustrated. “His wife is human…at least she doesn’t demonstrate any kind of latent abilities. Since males pass on the mutant gene, how could Cyclops sire someone that powerful?”

Dr. Windsor arched an eyebrow and smirked slightly, “You don’t trust my judgment?”

“People!” Dr. Suriyama yelled as she slammed her fist on the table. She collected herself before she continued with her presentation.

“Suffice to say, this World that we have created is war-torn beyond repair,” Janis said. “However, the advances in weaponry, knowledge, fighting techniques, and military tactics are well beyond what the conventional world has to offer. I’m not sure that putting in a child in that environment would be safe.” Janis looked down at an open folder on the table, “A trained soldier, however…the one the Director wants.” She fumbled through some papers, “First Sergeant Wade T. Wilson? Might be a better choice in this case.”

Essex silently scowled within himself. All it took was a slight mental nudge to sway Dr. Suriyama’s decision, but he knew all too well that it would tip off Dr. Russell to his true intentions. He gripped his chin in deep thought, emerging seconds later, “He’ll have his sister look after him. She’s the heir to the Phoenix Force.”

“…the what?” Diana wondered.

“Apparently, you haven’t been paying attention to your race’s own media frenzy,” Dr. Suriyama smirked.

“Oh, right…I was thinking of Baron Zemo…uh….nevermind,” Dr. Russell said as she shook her head. “How are we going to control this…god-like force of nature?”

Dr. Windsor smiled, “Your world-renowned hypno-therapy. As long as that thing has a human host, it has to play by the rules of a human mind.”

“What about the…girl?” Diana asked.

“She’s involved, too,” Dr. Suriyama said. “She’s keeping this artificial timeline of ours stable.”

Dr. Russell shook her head, “All of this…just to turn a human being into the ultimate weapon?”

“The greater good, Diana,” Dr. Suriyama said. “I’m sure the greatest minds of the 1930s that came up with the atom bomb had good intentions just as we do.” It was then that Diana looked up at the screen once more and pondered her role in this…and how she could make the most of it. How she could create a beacon of hope in the midst of chaos.

Meanwhile, in the stirring thoughts of Dr. Windsor, Nathanial Essex, the devil within, laughed maniacally. He would be rid of En Sabah Nur forever. The white-haired man who traversed time inspired his own origin. It was what Dr. Suriyama would call a "predestination paradox." And Mr. Sinister would stop at nothing to let it pass.

“…the greater good,” Dr. Windsor smirked as he stared up at the large title on the screen projector.

PROJECT: ASKANI

- Dr. Diana Russell once treated Cable with his form of post traumatic stress disorder in M2K'sCable 2002 Annual, where she first appeared.

- When last we saw of Cable, he merged with his alternate reality self, Nate Grey, and became one with the universe in the Cable 2003 Annual. He later briefly appeared to the X-Men's Cyclops, Phoenix, Domino, and Cannonball in his new godly form in the X-Men Prime 2004 Annual.

- Tanya Trask was the daughter of Bolivar Trask, creator of the mutant-hunting Sentinels. Tanya went on to become Madame Sanctity alongside Mother Askani (Rachel Summers, Cable's sister from an alternate timeline) when she was flung into the far future. When Rachel seemingly died, Sanctity transformed the Askani from a ragtag rebellion into a bona fide sisterhood, accepting only psionics into their ranks. This eventually led to the creation of the Dukani--a more ruthless version of what the Askani represented. Cable dealt with Sanctity and her Dukani in the present, eventually leading to their defeat in M2K's Cable #48.